• Creator: guest178
• Population: 0
• Generation: 0
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: TCCCTAACCCGTACCTCCGTACGTTGGCGA
• Function:

  10 *(log(10 *(numbers('yyx')), numbers('yyx'))) if max(10 *(log(10 *(numbers('yyx')), numbers('yyx'))), log(10 *(numbers('yyx')), numbers('yyx'))) > log(10 *(numbers('yyx')), numbers('yyx')) else 10 *(numbers('yyx'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.