• Creator: guest178
• Population: 0
• Generation: 1
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: ATTCAGAGTCCAATAATTTAAATCACCCTGTTC
• Function:

  gradient[0](minus(gradient[1](product(logn(gradient[0](numbers("xxx"))), gradient[0](numbers("xxx")))), product(logn(gradient[0](numbers("xxx"))), gradient[0](numbers("xxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.