• Creator: Big_Ndawg
• Population: 0
• Generation: 1
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: CAGATAACTCGACGGCGTTTGGGACTGAAGTAC
• Function:

  minus(logn(2 *(mod(exp(log(numbers('epe'), numbers("xxr")), numbers('epe')), log(numbers('epe'), numbers("xxr"))))), 2 *(mod(exp(log(numbers('epe'), numbers("xxr")), numbers('epe')), log(numbers('epe'), numbers("xxr")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.