• Creator: Big_Ndawg
• Population: 0
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: TGGTTGCGGAAAACTTAAAATACAGGGGTC
• Function:

  numbers("xxx") if exp(abs(2 *(numbers("xxx"))), 2 *(numbers("xxx"))) > 2 *(numbers("xxx")) else abs(2 *(numbers("xxx"))) if 2 *(numbers("xxx")) > exp(abs(2 *(numbers("xxx"))), 2 *(numbers("xxx"))) else abs(2 *(numbers("xxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.