header

genetic-algorithms.com

 

Inspect global_global_0_0_104

Parents

global_global_0_0_104 has no parents. It was generated at random.

global_global_0_0_104

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 40
  • No. Votes: 6
  • Avg. Fitness 6.7
  • Created: 05/19/2019
  • Genome: TTCACAATATCACAAGCCCGCGCATTACGG
  • Function:

    sum(numbers('yyx'), numbers('xry')) if logn(numbers("yyy") if sum(numbers('yyx'), numbers('xry')) > numbers('xry') else numbers('yyx')) > sum(numbers('yyx'), numbers('xry')) if numbers("yyy") > numbers('xry') else numbers('yyx') else gradient[2](logn(sum(numbers('yyx'), numbers('xry')) if numbers("yyy") > numbers('xry') else numbers('yyx')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest4634_0_1_347

Image 01

Genome: TTAGCGTGAGGGTATGACAAGGAAGAGGTAAGG

guest195_0_1_309

Image 01

Genome: TTCACAATATCACAAGGCCGCGAGGAATAGACT

guest94_0_1_284

Image 01

Genome: TAAACATTATCACAAGCCGGGGTGCTACGG

sina12345_0_1_228

Image 01

Genome: CATTTCAAAATATCACTCTACATCGCATTACGG

sina12345_0_1_163

Image 01

Genome: GGATTCACAATCTCGTAAGCCCGTGCAGTACGG

guest30_0_1_87

Image 01

Genome: TTCTCAAGCTGTCCGAAGTGGCGCACACGG

sina12345_0_1_209

Image 01

Genome: GCCTCATCTGTCTAGGCTACGCCGAGATTACGC

sina12345_0_1_181

Image 01

Genome: TGCAGGCTCTTGTCGACGGAGGAGGCACTGATT

guest52_0_1_104

Image 01

Genome: CCAGAAAACACCGCTTTGAGCGCACATCGT