• Creator: Citrus00
• Population: 0
• Generation: 12
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: GGTTTTACGAATAAACTGTCGTGTTACGGG
• Function:

  noise(abs(numbers('epe'))) if abs(numbers('epe')) > 100 *(noise(abs(numbers('epe')))) else numbers('epe') if noise(abs(numbers('epe'))) > abs(numbers('epe')) else 100 *(noise(abs(numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.