• Creator: Citrus00
• Population: 0
• Generation: 15
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: CCTCGGACAATGCCAAGAAACAATCGTCGTGACCTC
• Function:

  divide(exp(gradient[2](sqrt(product(sin(numbers("xxy")), numbers("xxy")))), sqrt(product(sin(numbers("xxy")), numbers("xxy")))), gradient[2](sqrt(product(sin(numbers("xxy")), numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.