header

genetic-algorithms.com

 

Inspect guest7857_0_0_10

Parents

guest7857_0_0_10 has no parents. It was generated at random.

guest7857_0_0_10

Image 01

  • Creator: guest7857
  • Population: 0
  • Generation: 0
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 11/07/2023
  • Genome: TGGTTGACTCGCTGAATGTGCACAACTCCC
  • Function:

    round(numbers('xyy') if numbers('epe') > numbers('xry') else numbers("yyy"), numbers('epe')) if 2 *(round(numbers('xyy') if numbers('xry') > numbers("yyy") else numbers('epe'), numbers('epe'))) > numbers("yyy") if numbers('xyy') > numbers('epe') else numbers('xry') else numbers('xyy') if numbers("yyy") > numbers('epe') else numbers('xry') if 2 *(round(numbers('epe') if numbers("yyy") > numbers('xry') else numbers('xyy'), numbers('epe'))) > numbers('epe') else round(numbers('xyy') if numbers('epe') > numbers("yyy") else numbers('xry'), numbers('epe'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest7857_0_0_10 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!