• Creator: guest195
• Population: 0
• Generation: 2
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: ACGCGCATGCGGCCACACGCTTCCTTCACGGATGAC
• Function:

  100 *(round(sqrt(exp(product(sum(numbers('xyy'), numbers('yyx')), numbers('xyy')), sum(numbers('xyy'), numbers('yyx')))), exp(product(sum(numbers('xyy'), numbers('yyx')), numbers('xyy')), sum(numbers('xyy'), numbers('yyx')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.