• Creator: guest8200
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 02/11/2024
• Genome: AATGACTAGAATACATTCAGGAACCCGAAA
• Function:

  noise(numbers('rep') if noise(gradient[2](numbers('rep'))) > numbers('rep') if numbers('yxr') > gradient[2](numbers('rep')) else noise(gradient[2](numbers('rep'))) else gradient[2](numbers('rep')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.