header

genetic-algorithms.com

 

Inspect guest8200_0_0_2

Parents

guest8200_0_0_2 has no parents. It was generated at random.

guest8200_0_0_2

Image 01

  • Creator: guest8200
  • Population: 0
  • Generation: 0
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 02/11/2024
  • Genome: GAAGGTATTACCCCTCCATGTCGATACTTA
  • Function:

    10 *(divide(numbers("yyy"), numbers('ryy'))) if gradient[0](10 *(divide(numbers("yyy"), numbers('ryy')))) > divide(numbers("yyy"), numbers('ryy')) else numbers("yyy") if gradient[0](10 *(divide(numbers("yyy"), numbers('ryy')))) > 10 *(divide(numbers("yyy"), numbers('ryy'))) else divide(numbers("yyy"), numbers('ryy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest8200_0_1_16

Image 01

Genome: TAAAGAATTACGCCTCCATGTGGATACTTA

guest8200_0_1_3

Image 01

Genome: AACGTGGTGTGCGCTTTACATCCTCTATACTTT

guest8200_0_1_25

Image 01

Genome: GGCTTCGGTATTATCGAAAGTTTGGCTCACTAG