header

genetic-algorithms.com

 

Inspect guest8200_0_0_6

Parents

guest8200_0_0_6 has no parents. It was generated at random.

guest8200_0_0_6

Image 01

  • Creator: guest8200
  • Population: 0
  • Generation: 0
  • Total Fitness: 7
  • No. Votes: 1
  • Avg. Fitness 7
  • Created: 02/11/2024
  • Genome: TGAAGGGTATGGGTCCAGGGGGCAAACTGG
  • Function:

    tan(numbers('yxr') if numbers("xyx") > numbers("yyy") else numbers("xxy") if numbers("xyx") > numbers('yxr') if numbers("yyy") > numbers("yyy") if numbers("xxy") > numbers('yxr') else numbers("xyx") else numbers("xyx") else numbers('yxr')) if numbers("yyy") if numbers('yxr') if numbers("yyy") > numbers("xyx") else numbers("xxy") > numbers("xyx") else numbers('yxr') > numbers('yxr') if numbers("xyx") if numbers("xxy") > numbers("yyy") else numbers('yxr') > numbers("xyx") else numbers("yyy") if numbers('yxr') > numbers("xxy") if numbers("xyx") > numbers('yxr') else numbers("yyy") else numbers("xyx") else numbers('yxr') if numbers("xxy") > numbers("yyy") else numbers("xyx")

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest8200_0_1_6

Image 01

Genome: CAATGAAGGGTATGGGTCCAGGGGGCGAACTGG

guest8200_0_1_19

Image 01

Genome: TGAAAGGTATGGGTGCGGGATGCAAACTGG

guest8200_0_1_2

Image 01

Genome: GCCAGGAGAACCACGGATTCCCGTGCTAACTTA