header

genetic-algorithms.com

 

Inspect guest8200_0_2_8

Parents

Mother

Image 01

guest8200_0_1_13

Genome: TATAGCGTCGTAGTGCTTCGGGTACTTAACCCC

Father

Image 01

guest8200_0_1_22

Genome: GTAACCGATTCGGGTGATCATTTTTGCACCGTC

guest8200_0_2_8

Image 01

  • Creator: guest8200
  • Population: 0
  • Generation: 2
  • Total Fitness: 8
  • No. Votes: 1
  • Avg. Fitness 8
  • Created: 02/11/2024
  • Genome: CATTATAACGTCGAAGTGCGTCGGGTACTTAACTCG
  • Function:

    minus(square(numbers('ryy') if numbers('yxr') if numbers('ryy') > numbers("per") else numbers('ryy') if numbers('yxr') > numbers('rrr') else numbers("per") > numbers('ryy') if numbers('yxr') > numbers("per") else numbers('rrr') else numbers('yxr')) if numbers('ryy') if numbers('yxr') > numbers("per") else numbers('rrr') > numbers('rrr') if numbers('ryy') > numbers('yxr') else numbers("per") if numbers('ryy') > numbers('yxr') else numbers("per") else numbers('ryy') if numbers('yxr') > numbers("per") else numbers("per") if numbers('ryy') > numbers('yxr') else numbers('rrr') if numbers("per") if numbers('yxr') > numbers('ryy') else numbers('rrr') > numbers('ryy') else numbers('yxr'), square(numbers("per") if numbers('yxr') > numbers('ryy') else numbers('rrr') if numbers('yxr') if numbers('ryy') if numbers('yxr') > numbers('rrr') else numbers("per") > numbers("per") else numbers('ryy') > numbers('yxr') else numbers('ryy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest8200_0_3_2

Image 01

Genome: GTCCCAGATCCTATGCTGAAACCGTGCTAGCGA

guest8200_0_3_16

Image 01

Genome: AACGTTGTGTGCGCTTTACATGGAGCGATGATT