• Creator: guest8200
• Population: 0
• Generation: 3
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 02/11/2024
• Genome: CAGAGAAGAATTATACCTCCATGAGGCTGA
• Function:

  minus(sin(sin(gradient[0](logn(numbers('xyy'))))), sin(gradient[0](logn(numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.