header

genetic-algorithms.com

 

Inspect guest8200_0_3_28

Parents

guest8200_0_3_28 has no parents. It was generated at random.

guest8200_0_3_28

Image 01

  • Creator: guest8200
  • Population: 0
  • Generation: 3
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 02/11/2024
  • Genome: CACTAGTGGGCATCCTCCCTGACAATTTCA
  • Function:

    sum(numbers('epe') if numbers('yyx') > numbers("yyy") else numbers('yyx') if numbers('rrr') > numbers("yyy") else numbers('epe') if numbers('yyx') if numbers('epe') > numbers("yyy") else numbers("yyy") if numbers('rrr') > numbers('yyx') else numbers('epe') if numbers('epe') > numbers('rrr') if numbers('yyx') > numbers('epe') else numbers("yyy") else numbers('yyx') > numbers('yyx') else numbers('epe') if numbers('rrr') > numbers('yyx') else numbers("yyy"), numbers('yyx') if numbers('rrr') if numbers("yyy") > numbers('epe') else numbers('yyx') > numbers('epe') else numbers("yyy") if numbers('yyx') > numbers('epe') else numbers('rrr') if numbers('epe') > numbers("yyy") else numbers('yyx'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest8200_0_4_4

Image 01

Genome: CACTAGTGGGCATCCTCCATGACAATTTCA

guest8200_0_4_6

Image 01

Genome: CACCACTAGTGGGCATGCTCGCGGCCAATTTCA

guest8200_0_4_15

Image 01

Genome: CAGCACTAGTGGGCATACTCGCTGACAATTGAA

guest8200_0_4_16

Image 01

Genome: CACTAGTGGGCATCCTCCTTGACAATTTCA

guest8200_0_4_17

Image 01

Genome: CGGCACTAGTGGGCATCCTCCGGGACAATTTCA

guest8200_0_4_11

Image 01

Genome: ACTAGGTTCTCCAGGTTGACCATACGTTCC

guest8200_0_4_25

Image 01

Genome: AGGCAGAGAAGAGTATCCTCTCCATGATTCTGA