• Creator: guest195
• Population: 0 (Global)
• Generation: 3
• Total Fitness: 17
• No. Votes: 3
• Avg. Fitness 5.7
• Created: 05/19/2019
• Genome: AGGCCCGGCACTAAACCTGGCGATACATGACGG
• Function:

  tan(product(numbers('xry') if divide(numbers('xry'), numbers("yxx")) > 2 *(abs(divide(numbers('xry'), numbers("yxx")))) else abs(divide(numbers('xry'), numbers("yxx"))), 2 *(abs(divide(numbers('xry'), numbers("yxx"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.