header

genetic-algorithms.com

 

Inspect guest34_0_0_7

Parents

guest34_0_0_7 has no parents. It was generated at random.

guest34_0_0_7

Image 01

  • Creator: guest34
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: GACAAAGTTATGGCCATGTGACCAACAAAT
  • Function:

    numbers('epe') if sqrt(numbers("yyy") if numbers("xxr") > numbers('epe') else numbers("yyy")) > numbers("xxr") else numbers('epe') if numbers("xxr") > numbers("yyy") else numbers("yyy") if sqrt(numbers("xxr") if numbers("yyy") > numbers('epe') else numbers("yyy")) > abs(numbers('epe') if sqrt(numbers("yyy") if numbers("yyy") > numbers('epe') else numbers("xxr")) > numbers("xxr") else numbers("xxr") if numbers("yyy") > numbers('epe') else numbers("yyy")) else numbers("yyy") if numbers('epe') > numbers("yyy") else numbers("xxr")

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest34_0_0_7 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!