• Creator: global
• Population: 0 (Global)
• Generation: 1
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: GGTACATAGCGGACTTATACGGATTTTTGT
• Function:

  2 *(numbers("yxx")) if gradient[2](exp(2 *(numbers("yxx")), numbers("yxx")) if numbers('yxy') > numbers("yxx") else 2 *(numbers("yxx"))) > exp(2 *(numbers("yxx")), numbers("yxx")) if numbers("yxx") > 2 *(numbers("yxx")) else numbers('yxy') else exp(2 *(numbers("yxx")), numbers("yxx"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.