• Creator: guest200
• Population: 0
• Generation: 4
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: AATGATAGTACGTTAACGCGCACGCCCTGCTGAAAT
• Function:

  noise(numbers('xry') if numbers('yyx') > 100 *(numbers('xry')) else numbers('yxy') if 100 *(numbers('yyx') if numbers('yxy') > 100 *(numbers('xry')) else numbers('xry')) > gradient[1](100 *(numbers('xry') if 100 *(numbers('xry')) > numbers('yxy') else numbers('yyx'))) else 100 *(numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.