header

genetic-algorithms.com

 

Inspect guest200_0_5_22

Parents

Mother

Image 01

guest200_0_4_19

Genome: AGTTGCGTGATACCGATACCTAGGGTAATT

Father

Image 01

guest200_0_4_1

Genome: ATGAGCTGCGTGATAGCGATTCCTGGATGTTGT

guest200_0_5_22

Image 01

  • Creator: guest200
  • Population: 0
  • Generation: 5
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 05/19/2019
  • Genome: AATTGCGTGATAATAATACCTAGGGTAATT
  • Function:

    noise(logn(numbers("per")) if logn(logn(numbers("per"))) > numbers("per") if logn(logn(numbers("per"))) > numbers('xyy') else logn(numbers("per")) else numbers("per"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest200_0_5_22 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!