• Creator: guest200
• Population: 0
• Generation: 6
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: TGCCGTACTACTAAAATCTCCGGATGGACT
• Function:

  log(2 *(2 *(abs(numbers('rep')))), 2 *(abs(numbers('rep')))) if 2 *(abs(numbers('rep'))) > abs(numbers('rep')) else 2 *(2 *(abs(numbers('rep'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.