• Creator: guest202
• Population: 0
• Generation: 6
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: CTGAGATAAATTCGAACCTCTTCCCCGACCTTTAGG
• Function:

  mean(sin(10 *(numbers('xyy')) if gradient[0](mod(10 *(numbers('xyy')), numbers('xyy'))) > numbers('xyy') else mod(10 *(numbers('xyy')), numbers('xyy'))), numbers('xyy') if gradient[0](mod(10 *(numbers('xyy')), numbers('xyy'))) > 10 *(numbers('xyy')) else mod(10 *(numbers('xyy')), numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.