• Creator: guest202
• Population: 0
• Generation: 6
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TGGAGATCAATTCGAACCTCTTCCCAGATACTTGCC
• Function:

  numbers('xyy') if mod(10 *(numbers('xyy')), numbers('xyy')) > 10 *(numbers('xyy')) else gradient[0](mod(10 *(numbers('xyy')), numbers('xyy'))) if gradient[0](mod(10 *(numbers('xyy')), numbers('xyy'))) > sin(10 *(numbers('xyy')) if gradient[0](mod(10 *(numbers('xyy')), numbers('xyy'))) > numbers('xyy') else mod(10 *(numbers('xyy')), numbers('xyy'))) else mod(10 *(numbers('xyy')), numbers('xyy'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.