header

genetic-algorithms.com

 

Inspect global_global_0_0_12

Parents

global_global_0_0_12 has no parents. It was generated at random.

global_global_0_0_12

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 21
  • No. Votes: 6
  • Avg. Fitness 3.5
  • Created: 05/19/2019
  • Genome: AGCGCGCTGATTGCCTTGTATCTATCCAAA
  • Function:

    cos(numbers('yyx') if numbers("per") > numbers("yxx") else numbers('epe') if numbers('epe') > gradient[0](numbers('epe') if numbers('yyx') > numbers("per") else numbers("yxx")) else mean(gradient[0](numbers('yyx') if numbers('epe') > numbers("yxx") else numbers("per")), numbers('yyx') if numbers('epe') > numbers("yxx") else numbers("per")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest30_0_1_84

Image 01

Genome: AGCGCGCTGATTGCATTGTATCTGTCGAAA

sina12345_0_1_161

Image 01

Genome: AGCGCGCGGTTAGAGCAGACTGTGTCCAAA

sina12345_0_1_224

Image 01

Genome: AGCGCGATGATTAATGTACACCGTTGAGAA

guest94_0_1_278

Image 01

Genome: TAAAGCGTGCTGATTGACAAGTGGCGCACCAAA

guest195_0_1_298

Image 01

Genome: AGCGTATAAACTAGACCTCGGCAATCCAAA

guest200_0_1_337

Image 01

Genome: CCTAGCGCGCTGATTGCCTTGTATCCATCCTAA