• Creator: guest237
• Population: 0
• Generation: 2
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: TTGCCTAGCCGAACCGACCCTTCAGTTACA
• Function:

  mod(10 *(numbers("xxy")), numbers("xxy")) if divide(cos(mod(10 *(numbers("xxy")), numbers("xxy"))), mod(10 *(numbers("xxy")), numbers("xxy"))) > 10 *(numbers("xxy")) else cos(mod(10 *(numbers("xxy")), numbers("xxy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.