• Creator: guest237
• Population: 0
• Generation: 11
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: CGGACAACGAAACAGCTATTTACAATTGTAAGT
• Function:

  exp(gradient[2](100 *(abs(minus(max(numbers('rrr'), numbers("yyy")), numbers('rrr'))))), 100 *(abs(minus(max(numbers('rrr'), numbers("yyy")), numbers('rrr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.