• Creator: guest263
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: GAACCACGCCCCACTCTTGACATTTGTATC
• Function:

  product(2 *(numbers('rrr')), numbers('rrr')) if 2 *(numbers('rrr')) > product(round(product(2 *(numbers('rrr')), numbers('rrr')), 2 *(numbers('rrr'))), product(2 *(numbers('rrr')), numbers('rrr'))) else round(product(2 *(numbers('rrr')), numbers('rrr')), 2 *(numbers('rrr')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.