• Creator: guest263
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: GAACCACGCCCCACTCTTGACATTTGTATC
• Function:

  round(product(2 *(numbers('rrr')), numbers('rrr')), 2 *(numbers('rrr'))) if product(round(product(2 *(numbers('rrr')), numbers('rrr')), 2 *(numbers('rrr'))), product(2 *(numbers('rrr')), numbers('rrr'))) > product(2 *(numbers('rrr')), numbers('rrr')) else 2 *(numbers('rrr'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.