header

genetic-algorithms.com

 

Inspect guest280_0_0_16

Parents

guest280_0_0_16 has no parents. It was generated at random.

guest280_0_0_16

Image 01

  • Creator: guest280
  • Population: 0
  • Generation: 0
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: AGATGTGAATGCATTATTGAGGGCTTGTGA
  • Function:

    sin(gradient[0](numbers('rrr')) if numbers("xyx") > numbers('rrr') else numbers('xry') if numbers('rrr') > gradient[0](numbers('rrr')) else numbers('rrr') if numbers('xry') > numbers("xyx") else gradient[0](numbers('rrr')) if numbers('rrr') > numbers("xyx") else gradient[0](numbers('rrr')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest280_0_0_16 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!