• Creator: guest280
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: CAAATCACATCTATTATGCGATTGGGAGGT
• Function:

  sum(band pass(gradient[2](numbers("xxr") if numbers('epe') > gradient[0](numbers('epe')) else numbers('epe'))), gradient[2](numbers('epe') if numbers('epe') > numbers("xxr") else gradient[0](numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.