• Creator: guest280
• Population: 0
• Generation: 1
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: AGTCGTTACATTCACGTTGATAATTGTATT
• Function:

  gradient[1](log(sum(numbers('rrr'), numbers("yxx")) if gradient[0](sum(numbers('rrr'), numbers("yxx"))) > numbers('rrr') else numbers("yxx"), gradient[0](sum(numbers('rrr'), numbers("yxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.