• Creator: guest280
• Population: 0
• Generation: 2
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: AGTCGTTACATTCGAATCGCTCCCAGTATT
• Function:

  gradient[1](log(numbers('rep') if numbers('xyy') > gradient[0](mod(numbers('rep'), numbers('xyy'))) else mod(numbers('rep'), numbers('xyy')), gradient[0](mod(numbers('rep'), numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.