• Creator: complexadaptive
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: TCGGTACGTACCCCCCAAGGCTGGTAGTCT
• Function:

  product(numbers("xxx"), numbers('xry')) if log(10 *(product(numbers("xxx"), numbers('xry'))), product(numbers("xxx"), numbers('xry'))) > 10 *(product(numbers("xxx"), numbers('xry'))) else product(numbers("xxx"), numbers('xry')) if numbers("xxx") > log(10 *(product(numbers("xxx"), numbers('xry'))), product(numbers("xxx"), numbers('xry'))) else 10 *(product(numbers("xxx"), numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.