• Creator: complexadaptive
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: ACTGTAATCATTCTAGGTCCTTGGTATCCT
• Function:

  2 *(numbers('ryy') if band pass(gradient[0](max(numbers('ryy'), numbers('xyy')))) > max(numbers('ryy'), numbers('xyy')) else gradient[0](max(numbers('ryy'), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.