• Creator: guest315
• Population: 0
• Generation: 2
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: AACCAGTGTATCACGCATTTCGCACTTACG
• Function:

  square(minus(100 *(numbers("yxx")) if numbers('rep') > band pass(100 *(numbers("yxx"))) else numbers("yxx"), band pass(100 *(numbers("yxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.