• Creator: guest341
• Population: 0
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: TCCTGTAGTATTAGGGAGCTGTACGCCTGC
• Function:

  tan(numbers("xyx")) if tan(numbers("xyx")) if gradient[0](tan(numbers("xyx"))) > numbers("xyx") else gradient[1](gradient[0](tan(numbers("xyx")))) > gradient[1](gradient[0](tan(numbers("xyx")))) else gradient[0](tan(numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.