• Creator: guest341
• Population: 0
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: GCGGGGCCCATTACTCGTCCTGCCGTAGCTATG
• Function:

  gradient[0](2 *(log(numbers('xyy'), numbers('yyx')))) if product(gradient[0](2 *(log(numbers('xyy'), numbers('yyx')))), 2 *(log(numbers('xyy'), numbers('yyx')))) > product(gradient[0](2 *(log(numbers('xyy'), numbers('yyx')))), 2 *(log(numbers('xyy'), numbers('yyx')))) if gradient[0](2 *(log(numbers('xyy'), numbers('yyx')))) > 2 *(log(numbers('xyy'), numbers('yyx'))) else log(numbers('xyy'), numbers('yyx')) else 2 *(log(numbers('xyy'), numbers('yyx')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.