• Creator: guest341
• Population: 0
• Generation: 2
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: ACTTAGATTTTCATTTGCGTTCTGGGGGCC
• Function:

  2 *(numbers('xry') if gradient[0](numbers('xry')) > numbers('xry') if numbers('epe') > gradient[0](numbers('xry')) else numbers('rrr') else gradient[0](numbers('rrr') if numbers('xry') > numbers('epe') else gradient[0](numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.