• Creator: complexadaptive
• Population: 0
• Generation: 1
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: TACCAAACAACGATGGATGACAAGGTTGTA
• Function:

  sqrt(numbers("yxx")) if gradient[2](100 *(sqrt(numbers("yxx")))) > sum(gradient[2](100 *(sqrt(numbers("yxx")))), 100 *(sqrt(numbers("yxx")))) else 100 *(sqrt(numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.