• Creator: guest341
• Population: 0
• Generation: 4
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: GATGACATTAGTAGCACTGCCGAAGTAGGC
• Function:

  cos(numbers('xyy')) if gradient[0](gradient[1](cos(numbers('xyy')))) > gradient[1](cos(numbers('xyy'))) else gradient[0](gradient[1](cos(numbers('xyy')))) if cos(numbers('xyy')) > numbers('xyy') else gradient[1](cos(numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.