• Creator: guest341
• Population: 0
• Generation: 4
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: TCTACTGTCAATAGGACTGCGGATAGGAGGGCA
• Function:

  2 *(2 *(numbers('yxy')) if tan(2 *(numbers('yxy'))) > numbers('yxy') else noise(tan(2 *(numbers('yxy'))))) if tan(2 *(numbers('yxy'))) if noise(tan(2 *(numbers('yxy')))) > 2 *(numbers('yxy')) else numbers('yxy') > noise(tan(2 *(numbers('yxy')))) else tan(2 *(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.