• Creator: complexadaptive
• Population: 0
• Generation: 3
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: GTGGTCTCACCCACGGCTTCCTACTCCTTG
• Function:

  product(100 *(numbers('xyy')), numbers('xyy')) if numbers('xyy') if 100 *(numbers('xyy')) > product(100 *(numbers('xyy')), numbers('xyy')) if 100 *(numbers('xyy')) > numbers('xyy') else numbers('yyx') else product(100 *(numbers('xyy')), numbers('xyy')) > 100 *(numbers('xyy')) else 100 *(numbers('xyy')) if numbers('yyx') > numbers('xyy') else product(100 *(numbers('xyy')), numbers('xyy'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.