• Creator: admin
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: GTCCCTCCGACCAGCTAATAAATGTTGTTT
• Function:

  10 *(cos(numbers("xxx"))) if divide(divide(10 *(cos(numbers("xxx"))), cos(numbers("xxx"))), 10 *(cos(numbers("xxx")))) > cos(numbers("xxx")) else divide(10 *(cos(numbers("xxx"))), cos(numbers("xxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.