header

genetic-algorithms.com

 

Inspect global_global_0_0_161

Parents

global_global_0_0_161 has no parents. It was generated at random.

global_global_0_0_161

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 14
  • No. Votes: 4
  • Avg. Fitness 3.5
  • Created: 05/19/2019
  • Genome: GACCCACAAGGTGGACGTGATGATCGCGGA
  • Function:

    sum(numbers("yxx") if numbers('ryy') > numbers('ryy') if numbers('xry') > numbers("yxx") else numbers("yxx") else numbers("yxx"), numbers('xry') if numbers('ryy') > numbers("yxx") else numbers("yxx")) if numbers("yxx") if numbers('xry') if numbers('ryy') > numbers("yxx") else numbers("yxx") > numbers('ryy') else numbers("yxx") > numbers("yxx") if numbers('xry') > numbers("yxx") else numbers('ryy') else product(sum(numbers("yxx") if numbers('ryy') > numbers('xry') else numbers("yxx") if numbers('ryy') > numbers("yxx") else numbers("yxx"), numbers('xry') if numbers('ryy') > numbers("yxx") else numbers("yxx")), numbers("yxx") if numbers('xry') > numbers("yxx") else numbers('ryy') if numbers('ryy') > numbers("yxx") else numbers("yxx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest195_0_1_318

Image 01

Genome: GACCCACAAGGTGGACGTGATGATCGCGGC

guest195_0_1_314

Image 01

Genome: CCGGACCCACAAGGTGGACGTGGGACACGCGGA

sina12345_0_1_218

Image 01

Genome: TGCGGCCCACAATGTGGAAGTGATGATCGTCGA

sina12345_0_1_147

Image 01

Genome: GACCCACGAAGAGGACGTGATAATCTCGGA

sina12345_0_1_243

Image 01

Genome: GCGTCCCGTGAGGGCCAGGATGATCGTAAG

sina12345_0_1_187

Image 01

Genome: CGAGTATGATCTAATCTACGAACAGATCTTGTA