header

genetic-algorithms.com

 

Inspect guest47_0_0_4

Parents

guest47_0_0_4 has no parents. It was generated at random.

guest47_0_0_4

Image 01

  • Creator: guest47
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: TGTACCAAAGGGACAGGAAGGTCTCGTATT
  • Function:

    gradient[2](numbers("xxr")) if numbers('xyy') > numbers("xxr") else numbers('yxr') if abs(numbers('xyy') if numbers('yxr') > numbers("xxr") else gradient[2](numbers("xxr"))) > gradient[2](numbers("xxr")) else 10 *(abs(numbers('xyy') if numbers('yxr') > numbers("xxr") else gradient[2](numbers("xxr"))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest47_0_0_4 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!