header

genetic-algorithms.com

 

Inspect guest47_0_0_8

Parents

guest47_0_0_8 has no parents. It was generated at random.

guest47_0_0_8

Image 01

  • Creator: guest47
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: ATATGTCTCCTGCATCTCTGAATGTTCAAT
  • Function:

    logn(min(mean(minus(numbers('rep'), numbers("xxr")), numbers('rep')), minus(numbers('rep'), numbers("xxr"))) if numbers('rep') > minus(numbers('rep'), numbers("xxr")) else mean(minus(numbers('rep'), numbers("xxr")), numbers('rep')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest47_0_1_26

Image 01

Genome: ATATGTCTCCTGCATTTCTGAATATTCAAT