• Creator: guest464
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 06/06/2019
• Genome: TCTTTGCTGACTAGATGCTAGAGTAGTAGT
• Function:

  numbers('xry') if mean(2 *(sin(numbers('xry'))), sin(numbers('xry'))) > 2 *(sin(numbers('xry'))) else sin(numbers('xry')) if sin(numbers('xry')) > mean(2 *(sin(numbers('xry'))), sin(numbers('xry'))) else 2 *(sin(numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.