• Creator: guest464
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 06/06/2019
• Genome: ATGCGCGGAAAGAGTCTGCAATTTAAACAA
• Function:

  sqrt(round(numbers("xxx") if invert(gradient[1](numbers('epe'))) > numbers('epe') else gradient[1](numbers('epe')), invert(gradient[1](numbers('epe')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.