header

genetic-algorithms.com

 

Inspect guest47_0_1_11

Parents

Mother

Image 01

guest47_0_0_6

Genome: AGGGCTAGATAGATATACGAGTTTTCTGTC

Father

Image 01

guest47_0_0_17

Genome: ATATGTTGAGGAGGGTGCCCATAGATTCCT

guest47_0_1_11

Image 01

  • Creator: guest47
  • Population: 0
  • Generation: 1
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 05/19/2019
  • Genome: AGGGCTAGATAGATATGCCCGTTTTCTGTC
  • Function:

    tan(numbers('xry') if numbers('rrr') if numbers('xry') > logn(numbers('xry')) else numbers('yxy') > sin(numbers('yxy') if numbers('xry') > logn(numbers('xry')) else numbers('rrr')) else logn(numbers('xry')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest47_0_2_15

Image 01

Genome: AGGGCTAGATAGATATGCCTGGGGATCGTC

guest47_0_2_22

Image 01

Genome: GTAGCCCGATAGATAAGACCGTTTTGATAG