header

genetic-algorithms.com

 

Inspect global_global_0_0_169

Parents

global_global_0_0_169 has no parents. It was generated at random.

global_global_0_0_169

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 15
  • No. Votes: 3
  • Avg. Fitness 5
  • Created: 05/19/2019
  • Genome: CAATAAGCAGGGAAGCGCAGCAGCGTAGCC
  • Function:

    sum(invert(numbers('xry')) if numbers('xry') > numbers('xry') else numbers('xry') if invert(numbers('xry')) > invert(numbers('xry')) if numbers('xry') > numbers('xry') else numbers('xry') if invert(numbers('xry')) > numbers('xry') else numbers('xry') else numbers('xry'), numbers('xry') if invert(numbers('xry')) > numbers('xry') else numbers('xry') if numbers('xry') > invert(numbers('xry')) else numbers('xry'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_1_239

Image 01

Genome: CAATAAGCGTGGAAGCGCAGGAGCATAGCC

sina12345_0_1_183

Image 01

Genome: CATTAAGCAGGGAAGCTGAGCGATATAGCC

guest52_0_1_118

Image 01

Genome: ACCCCGCGGGGGCTACGACCGAGGGGTTTAGCC

sina12345_0_1_240

Image 01

Genome: AGGAGTGTCGGCGAGAAGCGCAGCCTGAGAGAA