header

genetic-algorithms.com

 

Inspect guest47_0_1_24

Parents

Mother

Image 01

guest47_0_0_22

Genome: TACATTCAGGGCGAAGAGAGTTCGGGTGTG

Father

Image 01

guest47_0_0_17

Genome: ATATGTTGAGGAGGGTGCCCATAGATTCCT

guest47_0_1_24

Image 01

  • Creator: guest47
  • Population: 0
  • Generation: 1
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: TGCATTCCGGGTGAAGGTCCATCGGGAGTG
  • Function:

    numbers('ryy') if numbers("xxr") > numbers("yyy") else numbers('yxy') if numbers('yxy') > numbers("yyy") else numbers('ryy') if numbers('ryy') if numbers('yxy') > numbers("yyy") else numbers("xxr") > divide(numbers("xxr") if numbers("yyy") > numbers('ryy') else numbers('yxy') if numbers('yxy') > numbers('ryy') else numbers("yyy"), numbers("xxr") if numbers('ryy') > numbers('yxy') else numbers("yyy")) else gradient[0](divide(numbers('yxy') if numbers("xxr") if numbers('ryy') > numbers("yyy") else numbers('yxy') > numbers("yyy") else numbers('ryy'), numbers("xxr") if numbers("yyy") > numbers('yxy') else numbers('ryy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest47_0_1_24 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!